Products / Digital Product Passport
A Digital Product Passport turns a production code into a page that answers where the product came from, how it was caught or farmed, what it's made of, and what backs the claims on the pack — generated from the verified chain, not written by hand.
How it's made
Every passport is produced from the traceability record behind the product. It links to the Raw Material ID that produced it, which links back through processing, discharge, transshipment and the trip that caught it.
So no claim on a passport is one the underlying data can't support — and nothing has to be written twice. As the chain is built, the passport is built with it.
What a passport shows
The path from catch region to the product in hand — the fishing vessel, the method it used, its departure port, and the route the product traveled.
Brand, product name and GTIN, production date, packaging format, materials and dimensions — plus species, ingredients, nutrition and allergens.
The verified proof points attached to that batch, so a claim on the label can be opened and checked rather than taken on trust.
The chain itself, followed back from the product code to the source.
At production scale
Passports are created as production data flows in, one per production code, each carrying its own identifier and traceability code — across every product line and run, not only a showcase item.
Each passport stays connected to the shipment and container it traveled in — a specific code links to the specific product, not to a generic page about the brand.
Opened from the pack
When activated by the brand holder, the code on the packaging opens the passport for that exact product — no app, no account.
Checks what’s behind a private-label line, or follows a specific batch through the chain.
Reads the same verified record, without a separate submission being prepared for them.
Uses the code on the packaging and lands on the passport for that exact product.
Blue Meridian Tuna Slices Smoked In Oil 125gGTIN : 0298416203774|base unit or each
Base Product Information
Brand Item ID
40318
EAN / GTIN
0298416203774
Description
Succulent fillets of premium tuna Smoked in Oil with a delicate smoked flavour. A great centrepiece to any meal.
Scientific Name
Thunnus albacares
Ingredients
Naturally smoked purse seine or pole and line caught yellowfin tuna (Thunnus albacares) (*fish*) (60%), vegetable oil, water, salt.
Allergens
Fish and Their Derivatives
Product's Form
Canned
Raw Material Information
Comm Species Name
Yellowfin
Scientific Name
Thunnus albacares
Species Group
Tuna
AFSIS 3-A Code
YFT
Taxon Code
152511107002
DNA Sequence
ATGCCTAGGTCAATCGGATCA…
Fishing Method
Wild or Farmed
Wild Caught
Gear Type
with Purse lines
Catch Type
Free School Unassociated
What's coming
The hard part was never the traceability code. It's having verified data behind it — origin, composition, packaging and materials — captured as the product moves.
Publish a passport now, or build the foundation later under deadline pressure. See DPP readiness.
The result
Built for the whole ocean
SmarTuna works across all oceans, all seafood species, and every major fishing and farming method.
Developed by Pacifical, the team behind the traceability system used by the world's largest MSC-certified purse-seine tuna fishery.