SmarTuna

Products / Digital Product Passport

One code. The whole story behind the product.

A Digital Product Passport turns a production code into a page that answers where the product came from, how it was caught or farmed, what it's made of, and what backs the claims on the pack — generated from the verified chain, not written by hand.

See a passport
One per production code No app, no account DPP-ready

How it's made

Generated from the chain, not composed for it.

Every passport is produced from the traceability record behind the product. It links to the Raw Material ID that produced it, which links back through processing, discharge, transshipment and the trip that caught it.

So no claim on a passport is one the underlying data can't support — and nothing has to be written twice. As the chain is built, the passport is built with it.

What a passport shows

Four answers, one digital passport.

01

The journey

The path from catch region to the product in hand — the fishing vessel, the method it used, its departure port, and the route the product traveled.

02

The product

Brand, product name and GTIN, production date, packaging format, materials and dimensions — plus species, ingredients, nutrition and allergens.

03

The proof

The verified proof points attached to that batch, so a claim on the label can be opened and checked rather than taken on trust.

04

Track and trace

The chain itself, followed back from the product code to the source.

At production scale

Created automatically, not published by hand.

Passports are created as production data flows in, one per production code, each carrying its own identifier and traceability code — across every product line and run, not only a showcase item.

Each passport stays connected to the shipment and container it traveled in — a specific code links to the specific product, not to a generic page about the brand.

Opened from the pack

One page, three audiences.

When activated by the brand holder, the code on the packaging opens the passport for that exact product — no app, no account.

A retailer or auditor

Checks what’s behind a private-label line, or follows a specific batch through the chain.

A regulator

Reads the same verified record, without a separate submission being prepared for them.

A shopper

Uses the code on the packaging and lands on the passport for that exact product.

Blue Meridian Tuna Slices Smoked In Oil 125g, a tin of smoked tuna slices in oil Blue Meridian Tuna Slices Smoked In Oil 125gGTIN : 0298416203774|base unit or each
OverviewSpeciesPackagingNutritionAllergensGTINCircularityArt WorkDigital Tuna Product PassportsAll Fields

Base Product Information

Brand Item ID

40318

EAN / GTIN

0298416203774

Description

Succulent fillets of premium tuna Smoked in Oil with a delicate smoked flavour. A great centrepiece to any meal.

Scientific Name

Thunnus albacares

Ingredients

Naturally smoked purse seine or pole and line caught yellowfin tuna (Thunnus albacares) (*fish*) (60%), vegetable oil, water, salt.

Allergens

Fish and Their Derivatives

Product's Form

Canned

Raw Material Information

A yellowfin tuna, Thunnus albacares

Comm Species Name

Yellowfin

Scientific Name

Thunnus albacares

Species Group

Tuna

AFSIS 3-A Code

YFT

Taxon Code

152511107002

DNA Sequence

ATGCCTAGGTCAATCGGATCA…

Fishing Method

Wild or Farmed

Wild Caught

Gear Type

with Purse lines

Catch Type

Free School Unassociated

What's coming

From an advantage to an expectation.

The hard part was never the traceability code. It's having verified data behind it — origin, composition, packaging and materials — captured as the product moves.

Publish a passport now, or build the foundation later under deadline pressure. See DPP readiness.

The result

What this means for your business.

A verified product story, opened from the code on the pack
Generated automatically from the chain, at production scale
One record serving consumers, retailers, auditors and regulators
Claims that can be checked, not just displayed
Passport capability in place ahead of the requirement

Built for the whole ocean

Open a passport and see what's behind it.

SmarTuna works across all oceans, all seafood species, and every major fishing and farming method.

Developed by Pacifical, the team behind the traceability system used by the world's largest MSC-certified purse-seine tuna fishery.

Book a demo
See DPP readiness →